Relative abundances of different Syndiniales groups from surface water samples collected at the Martha's Vineyard Coastal Observatory (MVCO) monthly or bimonthly between 2013 and 2021 (NCEI Accession 0294384)
This dataset contains biological data collected in the North Atlantic Ocean from 2013-02-14 to 2021-12-20. These data include taxon. The instruments used to collect these data include CTD - profiler, PCR Thermal Cycler, and bucket. These data were collected by Rebecca J. Gast of Woods Hole Oceanographic Institution as part of the "Trojan Horses in the Marine Realm: Protist Parasite-host Dynamics in Coastal Waters (Coastal Parasites)" project. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2023-10-31.
The following is the text of the dataset description provided by BCO-DMO:
MVCO Syndiniales amplicon ASV counts
Dataset Description:
Methods and Sampling:
Water samples were collected monthly or bimonthly (September 2019 to October 2020) at the Martha's Vineyard Coastal Observatory (MVCO) from about 2 meters below the surface using bucket casts or a CTD deployed from R/V Tioga. Samples were transferred to a carboy in a cooler for transport back to the laboratory. Water was processed within 2 hours of collection. One liter of whole seawater was collected onto 47-millimeter (mm) 0.2-micrometer (µm) Millpore Isopore filters and stored at -20 degrees Celsius (°C) for DNA extraction and amplicon sequencing. Nucleic acids were extracted from half of a 47mm filter that was cut into small pieces using scissors and cleaned with alcohol in between samples. The lysis method followed a hot detergent plus bead disruption protocol (Gast et al., 2004). Filter pieces were placed in a sterile 2-milliliter (ml) microfuge tube and 2 x lysis buffer was added, along with approximately 50 microliters (µl) of beads. The tubes were vortexed for 30 seconds and then placed at 65°C for 5 minutes, followed by two cycles of vortex and heat incubation. Sodium chloride and CTAB were added, and the samples were incubated at 70°C for 10 minutes. Following extraction with an equal volume of chloroform, the aqueous phase was removed and precipitated overnight at -20°C with 0.6 volume of isopropanol. The recovered DNA pellet was resuspended in 20 µl of sterile water.
Amplification of the V4 region of the 18S ribosomal RNA gene was accomplished using the primers 574V4F (5’ [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5’ [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5’ adapter sequences (indicated by square brackets). PCR reactions were performed in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq DNA polymerase, 2 millimoles (mM) MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95°C for 5 minutes; 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 90 seconds; 72°C for 5 minutes; 4°C hold. No template negative controls were included. Each sample reaction was examined to confirm the correct product size of approximately 500 base pairs (bp). Triplicate reactions were pooled and sent to the RI-INBRE Molecular Informatics Core for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing.
Amplicon data collected in this work was combined with other MVCO time series amplicon data to examine the temporal variation in Syndiniales types. The prior sequencing effort covered samples collected between 2013-2019 and 2020-2021, and used the same primer set reported here. Trimmed and demultiplexed raw reads were imported into qiime2 and the forward reads were analyzed for high quality (Q value 30 over 90% of read), removal of chimeric sequences, identification of amplicon sequence variants (ASVs) at 100% similarity, removal of ASVs that occurred in fewer than 2 samples, and assignment of taxonomy using PR2 database. Show more...
The following is the text of the dataset description provided by BCO-DMO:
MVCO Syndiniales amplicon ASV counts
Dataset Description:
Methods and Sampling:
Water samples were collected monthly or bimonthly (September 2019 to October 2020) at the Martha's Vineyard Coastal Observatory (MVCO) from about 2 meters below the surface using bucket casts or a CTD deployed from R/V Tioga. Samples were transferred to a carboy in a cooler for transport back to the laboratory. Water was processed within 2 hours of collection. One liter of whole seawater was collected onto 47-millimeter (mm) 0.2-micrometer (µm) Millpore Isopore filters and stored at -20 degrees Celsius (°C) for DNA extraction and amplicon sequencing. Nucleic acids were extracted from half of a 47mm filter that was cut into small pieces using scissors and cleaned with alcohol in between samples. The lysis method followed a hot detergent plus bead disruption protocol (Gast et al., 2004). Filter pieces were placed in a sterile 2-milliliter (ml) microfuge tube and 2 x lysis buffer was added, along with approximately 50 microliters (µl) of beads. The tubes were vortexed for 30 seconds and then placed at 65°C for 5 minutes, followed by two cycles of vortex and heat incubation. Sodium chloride and CTAB were added, and the samples were incubated at 70°C for 10 minutes. Following extraction with an equal volume of chloroform, the aqueous phase was removed and precipitated overnight at -20°C with 0.6 volume of isopropanol. The recovered DNA pellet was resuspended in 20 µl of sterile water.
Amplification of the V4 region of the 18S ribosomal RNA gene was accomplished using the primers 574V4F (5’ [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5’ [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5’ adapter sequences (indicated by square brackets). PCR reactions were performed in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq DNA polymerase, 2 millimoles (mM) MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95°C for 5 minutes; 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 90 seconds; 72°C for 5 minutes; 4°C hold. No template negative controls were included. Each sample reaction was examined to confirm the correct product size of approximately 500 base pairs (bp). Triplicate reactions were pooled and sent to the RI-INBRE Molecular Informatics Core for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing.
Amplicon data collected in this work was combined with other MVCO time series amplicon data to examine the temporal variation in Syndiniales types. The prior sequencing effort covered samples collected between 2013-2019 and 2020-2021, and used the same primer set reported here. Trimmed and demultiplexed raw reads were imported into qiime2 and the forward reads were analyzed for high quality (Q value 30 over 90% of read), removal of chimeric sequences, identification of amplicon sequence variants (ASVs) at 100% similarity, removal of ASVs that occurred in fewer than 2 samples, and assignment of taxonomy using PR2 database. Show more...
Dataset Citation
- Cite as: Gast, Rebecca J. (2024). Relative abundances of different Syndiniales groups from surface water samples collected at the Martha's Vineyard Coastal Observatory (MVCO) monthly or bimonthly between 2013 and 2021 (NCEI Accession 0294384). https://www.ncei.noaa.gov/archive/accession/0294384. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
Dataset Identifiers
ISO 19115-2 Metadata
gov.noaa.nodc:0294384
Download Data |
|
Distribution Formats |
|
Ordering Instructions | Contact NCEI for other distribution options and instructions. |
Distributor |
NOAA National Centers for Environmental Information +1-301-713-3277 ncei.info@noaa.gov |
Dataset Point of Contact |
NOAA National Centers for Environmental Information ncei.info@noaa.gov |
Time Period | 2013-02-14 to 2021-12-20 |
Spatial Bounding Box Coordinates |
West: -70.567
East: -70.567
South: 41.325
North: 41.325
|
Spatial Coverage Map |
General Documentation |
|
Associated Resources |
|
Publication Dates |
|
Data Presentation Form | Digital table - digital representation of facts or figures systematically displayed, especially in columns |
Dataset Progress Status | Complete - production of the data has been completed Historical archive - data has been stored in an offline storage facility |
Data Update Frequency | As needed |
Purpose | This dataset is available to the public for a wide variety of uses including scientific research and analysis. |
Use Limitations |
|
Dataset Citation |
|
Cited Authors |
|
Principal Investigators |
|
Contributors | |
Resource Providers | |
Points of Contact |
|
Publishers | |
Acknowledgments |
Theme keywords |
NODC DATA TYPES THESAURUS
NODC OBSERVATION TYPES THESAURUS
WMO_CategoryCode
|
Data Center keywords | NODC COLLECTING INSTITUTION NAMES THESAURUS NODC SUBMITTING INSTITUTION NAMES THESAURUS Global Change Master Directory (GCMD) Data Center Keywords |
Instrument keywords | NODC INSTRUMENT TYPES THESAURUS BCO-DMO Standard Instruments Global Change Master Directory (GCMD) Instrument Keywords Originator Instruments |
Place keywords | NODC SEA AREA NAMES THESAURUS Global Change Master Directory (GCMD) Location Keywords |
Project keywords | BCO-DMO Standard Projects Funding Award Information |
Keywords | NCEI ACCESSION NUMBER |
Use Constraints |
|
Data License | |
Access Constraints |
|
Fees |
|
Lineage information for: dataset | |
---|---|
Processing Steps |
|
Output Datasets |
|
Acquisition Information (collection) | |
---|---|
Instrument |
|
Last Modified: 2025-04-22T16:43:41Z
For questions about the information on this page, please email: ncei.info@noaa.gov
For questions about the information on this page, please email: ncei.info@noaa.gov