Diatom amplicon sequencing variants (ASVs) from Narragansett Bay, Rhode Island, USA from 2008-2014 (NCEI Accession 0292206)

This dataset contains biological and survey - biological data collected from 2008-12-09 to 2014-12-30. These data include family, genus, kingdom, order, species, and taxon. The instruments used to collect these data include Automated DNA Sequencer, Niskin bottle, and PCR Thermal Cycler. These data were collected by Tatiana A. Rynearson of University of Rhode Island as part of the "Dimensions: Collaborative Research: Genetic, functional and phylogenetic diversity determines marine phytoplankton community responses to changing temperature and nutrients (Phytoplankton Community Responses)", "LTER: Linking Pelagic Community Structure with Ecosystem Dynamics and Production Regimes on the Changing Northeast US Shelf (NES LTER)", and "Narragansett Bay Long-Term Plankton Time Series (NBPTS)" projects and "Dimensions of Biodiversity (Dimensions of Biodiversity)" and "Long Term Ecological Research network (LTER)" programs. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2023-11-09.

The following is the text of the dataset description provided by BCO-DMO:

Diatom amplicon sequencing variants from Narragansett Bay 2008-2014

Dataset Description:
Methods and Sampling:
The methods reported below are summarized from Rynearson et al. (2020) and Fontaine and Rynearson (2023), two publications that used this dataset.

Filtered biomass sample collection, processing, and sequencing
As part of the Narragansett Bay Plankton Time Series (NBPTS), weekly surface water samples (9 meters depth) were collected between December 2008 and December 2014 from the west passage of Narragansett Bay (41°34.2'N, 71°23.4'W), a partially mixed estuary in the northwest Atlantic. Sampling occurred at a fixed location (historically this station has been called 'Station II') with a small boat operated by the University of Rhode Island (Cap'n Bert).

Water samples were filtered in triplicate onto 0.22-micrometer (μm) pore size, 25-millimeter (mm) diameter ExpressPlus filters (MilliporeSigma, Burlington, Massachussetts, USA) and stored at -80° Celsius (C) for later DNA extraction. Filter volume was dependent on the in situ Secchi depth; 100 milliliters (mL) of water were filtered per 1 meter (m) of Secchi depth which ranged from 1- 6 m. Previously extracted DNA from 68 monthly surface water samples collected between December 2008 and December 2014 was used here (Canesi and Rynearson, 2020) in addition to extracted DNA from 12 monthly samples collected between January and December 2014 (Rynearson et al. 2020).

To identify the diatoms present in each sample, a 420 base pair (bp) fragment within the variable V4 region of the 18S rDNA gene was amplified using primers D512 and D978rev (Zimmermann et al. 2011). Primers were modified by the addition of Illumina-specific adaptors: D512_illumina: 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATT CCAGCTCCAATAGCG 3' and D978_illumina: 5' GTCTCGTGGGCTCGGAGATGTGTATAA GAGACAGGACTACGATGGTATCTAATC 3'. Ten microliter PCR reactions contained the following reagents: 1x Bio-x-Act Short Mix (Bioline USA Inc., Taunton, Massachusetts, USA), 0.5 micromolar (µM) each forward and reverse primer and approximately 0.3-2.7 nanograms (ng) DNA template. Reactions were amplified with a multi-step thermocycler protocol, consisting of a two-minute denaturing step at 94°C, followed by 20 cycles of 30 seconds each at 94°C, 49°C and 72°C, followed by 15 cycles of 30 seconds each at 94°C, 67°C and 72°C, followed by 10 minutes at 72°C. PCR amplicons were cleaned with Ampure XP beads (Beckman Coulter, Inc., Brea, California, USA), quantified with the Qubit High Sensitivity DNA Assay Kit (Thermo Fisher Scientific, Inc., Waltham, Massachusetts, USA), amplified for an additional five cycles to add Nextera indices and adaptors (Illumina, Inc., San Diego, California, USA) and cleaned again with Ampure XP beads. PCR products were pooled with the KAPA qPCR kit (Kapa Biosystems, Wilmington, Massachusetts, USA) and sequenced on the Illumina MiSeq platform with V2 chemistry (2x250bp reads; Illumina, Inc., San Diego, California, USA) at the University of Rhode Island Genomics and Sequencing Center.

Raw sequence data can be found on NCBI under BioProject number PRJNA327394 ( https://www.ncbi.nlm.nih.gov/bioproject/327394 ).

Sampling Gaps:
Samples were not collected In February, March, April, and December 2012.