Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462)
This dataset contains biological, chemical, and physical data collected on Martha's Vineyard Coastal Observatory during deployment MVCO from 2013-02-14 to 2017-08-02. These data include 19-prime-butanoyloxyfucoxanthin, 19-prime-hexanoyloxyfucoxanthin, Ammonium, Si, carotene, chl_tot, chlorophyll a, chlorophyll b, chlorophyll c total, diadinoxanthin, diatoxanthin, fucoxanthin, nitrate plus nitrite, reactive phosphorus (PO4), total phaeopigment, water temperature, and zeaxanthin. The instruments used to collect these data include CTD Sea-Bird, Fluorometer, Niskin bottle, PCR Thermal Cycler, and bucket. These data were collected by Rebecca J. Gast of Woods Hole Oceanographic Institution as part of the "Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations (Staining IFCB)" project. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2020-06-08.
The following is the text of the dataset description provided by BCO-DMO:
Links to high throughput sequencing data and associated MVCO environmental measurements
Dataset Description:
This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI. These are described below and cited under "Related Datasets".
The following is the text of the dataset description provided by BCO-DMO:
Links to high throughput sequencing data and associated MVCO environmental measurements
Dataset Description:
This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI. These are described below and cited under "Related Datasets".
Dataset Citation
- Cite as: Gast, Rebecca J. (2023). Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462). https://www.ncei.noaa.gov/archive/accession/0278462. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
Dataset Identifiers
ISO 19115-2 Metadata
gov.noaa.nodc:0278462
Download Data |
|
Distribution Formats |
|
Ordering Instructions | Contact NCEI for other distribution options and instructions. |
Distributor |
NOAA National Centers for Environmental Information +1-301-713-3277 ncei.info@noaa.gov |
Dataset Point of Contact |
NOAA National Centers for Environmental Information ncei.info@noaa.gov |
Time Period | 2013-02-14 to 2017-08-02 |
Spatial Bounding Box Coordinates |
West: -70.5667
East: -70.5667
South: 41.325
North: 41.325
|
Spatial Coverage Map |
General Documentation |
|
Associated Resources |
|
Publication Dates |
|
Data Presentation Form | Digital table - digital representation of facts or figures systematically displayed, especially in columns |
Dataset Progress Status | Complete - production of the data has been completed Historical archive - data has been stored in an offline storage facility |
Data Update Frequency | As needed |
Supplemental Information | Acquisition Description: Surface water samples were collected at approximately 2m depth using a Niskin bottle or a bucket near the Martha’s Vineyard Coastal Observatory (MVCO) offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from February 2013 – August 2017 about every 1-2 months, and usually twice monthly April – November, for a total of 62 samples. Water was kept cool and in the dark for transport back to the laboratory (about 1.5 hours). Environmental data: Reported temperature data are from the CTD rosette aboard the R/V Tioga. Chlorophyll and phaeo were collected and analyzed in the Sosik lab at WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90% acetone. Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol summary can be found in the NES-LTER EDI data submission: https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-nes.1.2 HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary protocol for HPLC and chl is available from Seabass: https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents Sequencing data: Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto 45mm 0.22 µm Durapore GV filters under gentle vacuum. Filters were cut in half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until extraction. Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA MicroPrep Kit (Zymo Research Products). One half filter for each sample was transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer, and then shaken using a vortex adapter for 5 minutes. The extraction was then processed following the kit instructions and the eluted DNA frozen at -20C. The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and sequencing using 574V4F (5' [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5' [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq (in square brackets). PCR reactions were accomplished in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq GoldR 360 DNA polymerase, 2mM MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95C for 8 minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90 seconds; 72C for 5 minutes; 4C hold. No template negative controls were included with every set of PCRs. Each sample reaction was examined to confirm the correct product size of approximately 500 bp. Triplicate reactions were pooled and purified using either DNA Clean and Concentrator – 5 kit (Zymo Research) or AMPure XP beads. The samples were sent to the University of Rhode Island Genomics and Sequencing Center for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62 were sequenced in separate runs about a year apart. Ciliate-specific amplicons were generated by amplifying the region between 152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for amplification, and triplicate reactions were accomplished for each sample. Replicates were combined and purified using Agencourt AMPure XP. Products were sent to URI Genomics and Sequencing Center for Illumina MiSeq. V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging FlowCytobot Dashboard for shared access to image data and data products, including MVCO time series, is available at https://ifcb-data.whoi.edu/mvco and the WHOI dock time series is available at https://ifcb-data.whoi.edu/WHOI_dock . |
Purpose | This dataset is available to the public for a wide variety of uses including scientific research and analysis. |
Use Limitations |
|
Dataset Citation |
|
Cited Authors |
|
Principal Investigators |
|
Contributors | |
Resource Providers | |
Points of Contact |
|
Publishers | |
Acknowledgments |
Use Constraints |
|
Data License | |
Access Constraints |
|
Fees |
|
Lineage information for: dataset | |
---|---|
Processing Steps |
|
Output Datasets |
|
Acquisition Information (collection) | |
---|---|
Instrument |
|
Last Modified: 2025-04-22T16:43:38Z
For questions about the information on this page, please email: ncei.info@noaa.gov
For questions about the information on this page, please email: ncei.info@noaa.gov