Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462)

Acquisition Description:
Surface water samples were collected at approximately 2m depth using a Niskin bottle or a bucket near the Martha’s Vineyard Coastal Observatory (MVCO) offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from February 2013 – August 2017 about every 1-2 months, and usually twice monthly April – November, for a total of 62 samples. Water was kept cool and in the dark for transport back to the laboratory (about 1.5 hours).

Environmental data:
Reported temperature data are from the CTD rosette aboard the R/V Tioga. Chlorophyll and phaeo were collected and analyzed in the Sosik lab at WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90% acetone.

Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol summary can be found in the NES-LTER EDI data submission: https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-nes.1.2

HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary protocol for HPLC and chl is available from Seabass: https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents

Sequencing data:
Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto 45mm 0.22 µm Durapore GV filters under gentle vacuum. Filters were cut in half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until extraction.

Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA MicroPrep Kit (Zymo Research Products). One half filter for each sample was transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer, and then shaken using a vortex adapter for 5 minutes. The extraction was then processed following the kit instructions and the eluted DNA frozen at -20C.

The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and sequencing using 574V4F (5' [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5' [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq (in square brackets). PCR reactions were accomplished in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq GoldR 360 DNA polymerase, 2mM MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95C for 8 minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90 seconds; 72C for 5 minutes; 4C hold. No template negative controls were included with every set of PCRs. Each sample reaction was examined to confirm the correct product size of approximately 500 bp. Triplicate reactions were pooled and purified using either DNA Clean and Concentrator – 5 kit (Zymo Research) or AMPure XP beads. The samples were sent to the University of Rhode Island Genomics and Sequencing Center for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62 were sequenced in separate runs about a year apart.

Ciliate-specific amplicons were generated by amplifying the region between 152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for amplification, and triplicate reactions were accomplished for each sample. Replicates were combined and purified using Agencourt AMPure XP. Products were sent to URI Genomics and Sequencing Center for Illumina MiSeq.

V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging FlowCytobot Dashboard for shared access to image data and data products, including MVCO time series, is available at https://ifcb-data.whoi.edu/mvco and the WHOI dock time series is available at https://ifcb-data.whoi.edu/WHOI_dock .