Skip to main content
Dataset Overview | National Centers for Environmental Information (NCEI)

Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462)

browse graphicGraphic not available.
This dataset contains biological, chemical, and physical data collected on Martha's Vineyard Coastal Observatory during deployment MVCO from 2013-02-14 to 2017-08-02. These data include 19-prime-butanoyloxyfucoxanthin, 19-prime-hexanoyloxyfucoxanthin, Ammonium, Si, carotene, chl_tot, chlorophyll a, chlorophyll b, chlorophyll c total, diadinoxanthin, diatoxanthin, fucoxanthin, nitrate plus nitrite, reactive phosphorus (PO4), total phaeopigment, water temperature, and zeaxanthin. The instruments used to collect these data include CTD Sea-Bird, Fluorometer, Niskin bottle, PCR Thermal Cycler, and bucket. These data were collected by Rebecca J. Gast of Woods Hole Oceanographic Institution as part of the "Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations (Staining IFCB)" project. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2020-06-08.

The following is the text of the dataset description provided by BCO-DMO:

Links to high throughput sequencing data and associated MVCO environmental measurements

Dataset Description:
This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI. These are described below and cited under "Related Datasets".
  • Cite as: Gast, Rebecca J. (2023). Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462). https://www.ncei.noaa.gov/archive/accession/0278462. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
gov.noaa.nodc:0278462
Download Data
  • HTTPS (download)
    Navigate directly to the URL for data access and direct download.
  • FTP (download)
    These data are available through the File Transfer Protocol (FTP). FTP is no longer supported by most internet browsers. You may copy and paste the FTP link to the data into an FTP client (e.g., FileZilla or WinSCP).
Distribution Formats
  • TSV
Ordering Instructions Contact NCEI for other distribution options and instructions.
Distributor NOAA National Centers for Environmental Information(link is external)
+1-301-713-3277
ncei.info@noaa.gov
Dataset Point of Contact NOAA National Centers for Environmental Information(link is external)
ncei.info@noaa.gov
Time Period 2013-02-14 to 2017-08-02
Spatial Bounding Box Coordinates
West: -70.5667
East: -70.5667
South: 41.325
North: 41.325
Spatial Coverage Map
General Documentation
Associated Resources
  • Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO)
  • Gast, R. J. (2020) Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2020-06-05. https://doi.org/10.26008/1912/bco-dmo.814424.1
  • Parent ID (indicates this dataset is related to other data):
    • gov.noaa.nodc:BCO-DMO
Publication Dates
  • publication: 2023-05-19
Data Presentation Form Digital table - digital representation of facts or figures systematically displayed, especially in columns
Dataset Progress Status Complete - production of the data has been completed
Historical archive - data has been stored in an offline storage facility
Data Update Frequency As needed
Supplemental Information
Acquisition Description:
Surface water samples were collected at approximately 2m depth using a Niskin bottle or a bucket near the Martha’s Vineyard Coastal Observatory (MVCO) offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from February 2013 – August 2017 about every 1-2 months, and usually twice monthly April – November, for a total of 62 samples. Water was kept cool and in the dark for transport back to the laboratory (about 1.5 hours).

Environmental data:
Reported temperature data are from the CTD rosette aboard the R/V Tioga. Chlorophyll and phaeo were collected and analyzed in the Sosik lab at WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90% acetone.

Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol summary can be found in the NES-LTER EDI data submission: https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-nes.1.2

HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary protocol for HPLC and chl is available from Seabass: https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents

Sequencing data:
Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto 45mm 0.22 µm Durapore GV filters under gentle vacuum. Filters were cut in half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until extraction.

Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA MicroPrep Kit (Zymo Research Products). One half filter for each sample was transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer, and then shaken using a vortex adapter for 5 minutes. The extraction was then processed following the kit instructions and the eluted DNA frozen at -20C.

The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and sequencing using 574V4F (5' [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5' [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq (in square brackets). PCR reactions were accomplished in triplicate for each sample using 1 µl template DNA, 1.25 units AmpliTaq GoldR 360 DNA polymerase, 2mM MgCl2, 2 µl 2.5 µM dNTPs, and 2.5 µl 10X reaction buffer (25 µl total volume) with the conditions: 95C for 8 minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90 seconds; 72C for 5 minutes; 4C hold. No template negative controls were included with every set of PCRs. Each sample reaction was examined to confirm the correct product size of approximately 500 bp. Triplicate reactions were pooled and purified using either DNA Clean and Concentrator – 5 kit (Zymo Research) or AMPure XP beads. The samples were sent to the University of Rhode Island Genomics and Sequencing Center for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62 were sequenced in separate runs about a year apart.

Ciliate-specific amplicons were generated by amplifying the region between 152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for amplification, and triplicate reactions were accomplished for each sample. Replicates were combined and purified using Agencourt AMPure XP. Products were sent to URI Genomics and Sequencing Center for Illumina MiSeq.

V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging FlowCytobot Dashboard for shared access to image data and data products, including MVCO time series, is available at https://ifcb-data.whoi.edu/mvco and the WHOI dock time series is available at https://ifcb-data.whoi.edu/WHOI_dock .
Purpose This dataset is available to the public for a wide variety of uses including scientific research and analysis.
Use Limitations
  • accessLevel: Public
  • Distribution liability: NOAA and NCEI make no warranty, expressed or implied, regarding these data, nor does the fact of distribution constitute such a warranty. NOAA and NCEI cannot assume liability for any damages caused by any errors or omissions in these data. If appropriate, NCEI can only certify that the data it distributes are an authentic copy of the records that were accepted for inclusion in the NCEI archives.
Dataset Citation
  • Cite as: Gast, Rebecca J. (2023). Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462). https://www.ncei.noaa.gov/archive/accession/0278462. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
Cited Authors
Principal Investigators
Contributors
Resource Providers
Points of Contact
  • Biological and Chemical Oceanography Data Management Office (BCO-DMO)
Publishers
Acknowledgments
Theme keywords NODC DATA TYPES THESAURUS NODC OBSERVATION TYPES THESAURUS WMO_CategoryCode
  • oceanography
BCO-DMO Standard Parameters Global Change Master Directory (GCMD) Science Keywords Originator Parameter Names
Data Center keywords NODC COLLECTING INSTITUTION NAMES THESAURUS NODC SUBMITTING INSTITUTION NAMES THESAURUS Global Change Master Directory (GCMD) Data Center Keywords
Platform keywords BCO-DMO Platform Names Global Change Master Directory (GCMD) Platform Keywords
Instrument keywords NODC INSTRUMENT TYPES THESAURUS BCO-DMO Standard Instruments Global Change Master Directory (GCMD) Instrument Keywords Originator Instruments
Place keywords Provider Place Names
Project keywords BCO-DMO Standard Projects Funding Award Information Provider Deployment IDs
Keywords NCEI ACCESSION NUMBER
Use Constraints
  • Cite as: Gast, Rebecca J. (2023). Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (NCEI Accession 0278462). https://www.ncei.noaa.gov/archive/accession/0278462. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
Data License
Access Constraints
  • Use liability: NOAA and NCEI cannot provide any warranty as to the accuracy, reliability, or completeness of furnished data. Users assume responsibility to determine the usability of these data. The user is responsible for the results of any application of this data for other than its intended purpose.
Fees
  • In most cases, electronic downloads of the data are free. However, fees may apply for custom orders, data certifications, copies of analog materials, and data distribution on physical media.
Lineage information for: dataset
Processing Steps
  • 2023-05-19T04:44:30Z - NCEI Accession 0278462 v1.1 was published.
Output Datasets
Acquisition Information (collection)
Instrument
  • bucket
  • CTD
  • fluorometer
  • Niskin bottle
  • PCR machine
Last Modified: 2025-04-22T16:43:38Z
For questions about the information on this page, please email: ncei.info@noaa.gov