Skip to main content

Seagrass metrics from seagrass wasting disease mesocosm experiments conducted at Bodega Marine Laboratory from July-September 2015 (NCEI Accession 0291617)


 (MI_Metadata)
    fileIdentifier:  gov.noaa.nodc:0291617
    language:
      LanguageCode:  eng
    characterSet:  (MD_CharacterSetCode) utf8
    parentIdentifier:  gov.noaa.nodc:BCO-DMO
    hierarchyLevel:  (MD_ScopeCode) dataset
    hierarchyLevelName:  granule
    contact:  (CI_ResponsibleParty)
        organisationName:  NOAA National Centers for Environmental Information
        contactInfo:  (CI_Contact)
            address:  (CI_Address)
                electronicMailAddress:  ncei.info@noaa.gov
            onlineResource:  (CI_OnlineResource)
                linkage: https://www.ncei.noaa.gov/contact
                protocol:  HTTPS
                name:  NOAA Contact Information
                description:  Information for contacts at NCEI.
                function:  (CI_OnLineFunctionCode) information
        role:  (CI_RoleCode) custodian
    dateStamp:
      DateTime:  2025-04-22T16:43:27Z
    metadataStandardName:  ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data
    metadataStandardVersion:  ISO 19115-2:2009(E)
return to top
    identificationInfo:  (MD_DataIdentification)
        citation:  (CI_Citation)
            title:  Seagrass metrics from seagrass wasting disease mesocosm experiments conducted at Bodega Marine Laboratory from July-September 2015 (NCEI Accession 0291617)
            date:  (CI_Date)
                date:  2024-04-21
                dateType:  (CI_DateTypeCode) publication
            edition: (inapplicable)
            identifier:  (MD_Identifier)
                authority:  (CI_Citation)
                    title:  NOAA National Centers for Environmental Information
                    date: (inapplicable)
                code:
                  Anchor:  NCEI Dataset ID gov.noaa.nodc:0291617
            identifier:  (MD_Identifier)
                authority:  (CI_Citation)
                    title:  NCEI Archive Management System
                    date: (inapplicable)
                code:
                  Anchor:  NCEI Accession ID 0291617
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://ror.org/04r0wrp59 NOAA National Centers for Environmental Information
                contactInfo:  (CI_Contact)
                    address:  (CI_Address)
                        electronicMailAddress:  ncei.info@noaa.gov
                    onlineResource:  (CI_OnlineResource)
                        linkage: https://www.ncei.noaa.gov/contact
                        protocol:  HTTPS
                        name:  NCEI Contact Information
                        description:  Information for contacts at NCEI.
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) publisher
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://ror.org/00vcb3m70 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://bcodmo.org
                        protocol:  HTTP
                        name:  Biological and Chemical Oceanography Data Management Office (BCO-DMO) website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) resourceProvider
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  A. Randall Hughes
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/522929
                        protocol:  HTTP
                        name:  Northeastern University website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Katherine DuBois
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/881979
                        protocol:  HTTP
                        name:  University of California - Davis website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Melissa Kardish
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/715 Bodega Marine Laboratory (BML)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/881977
                        protocol:  HTTP
                        name:  Bodega Marine Laboratory (BML) website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Forest Schenck
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/851053
                        protocol:  HTTP
                        name:  Northeastern University website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  John J. Stachowicz
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/518660
                        protocol:  HTTP
                        name:  University of California - Davis website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:  Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/affiliation/191
                        protocol:  HTTP
                        name:  website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) pointOfContact
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Hughes, A. Randall
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/522929
                        protocol:  HTTP
                        name:  Northeastern University website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  DuBois, Katherine
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California-Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/881979
                        protocol:  HTTP
                        name:  University of California - Davis website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Kardish, Melissa
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/715 University of California-Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/881977
                        protocol:  HTTP
                        name:  Bodega Marine Laboratory (BML) website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Schenck, Forest
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/851053
                        protocol:  HTTP
                        name:  Northeastern University website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:  Stachowicz, John J.
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California-Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/518660
                        protocol:  HTTP
                        name:  University of California - Davis website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://www.ucdavis.edu
                        protocol:  HTTP
                        name:  University of California - Davis website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) contributor
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://www.northeastern.edu
                        protocol:  HTTP
                        name:  Northeastern University website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) contributor
            presentationForm:  (CI_PresentationFormCode) tableDigital
        abstract:  This dataset contains biological data collected from 2015-07-01 to 2015-09-14. These data include growth and temp_incub. The instruments used to collect these data include Aquarium, Aquarium chiller, Homogenizer, Immersion heater, and qPCR Thermal Cycler. These data were collected by A. Randall Hughes and Forest Schenck of Northeastern University and John J. Stachowicz, Katherine DuBois, and Melissa Kardish of University of California-Davis as part of the "CAREER: Linking genetic diversity, population density, and disease prevalence in seagrass and oyster ecosystems (Seagrass and Oyster Ecosystems)" project. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2022-11-22. The following is the text of the dataset description provided by BCO-DMO: Acquisition Description: Mesocosm experiment. We used a substitutive design to test the effects of eelgrass genotypic identity (eight genotypes), diversity (monocultures of 1 genotype vs. polycultures of 4 genotypes), and temperature (ambient or + 3.2° C) on the prevalence and intensity of the wasting disease parasite Labyrinthula over eight weeks in an array of flow-through 120-Liter mesocosms at the Bodega Marine Laboratory in Bodega Bay, CA. In July 2015, we created ten unique polyculture combinations of four genotypes (4 genotypes per experimental pot) randomly drawn from a pool of eight genotypes; all eight genotypes were also grown in monoculture (1 genotype per pot). We filled pots (8.9 x 8.9 cm) with coarsely sieved sediment collected from Bodega Harbor, and planted 4 shoots of eelgrass per pot, matching the lower range of average field densities reported for Bodega Harbor (Ha and Williams, 2018) to allow for growth during the experiment. Plants were originally collected in Bodega Harbor, CA in 2012, confirmed to be unique genotypes using 11 DNA microsatellite loci developed specifically for Zostera marina (Abbott et al. 2018), and propagated in separate flow through mesocosms at Bodega Marine Lab. We previously characterized traits of each genotype relating to growth rate, morphology, nutrient content, and chemical defense in common garden experiments at ambient temperature from July 2013 to August 2014 (Abbott et al., 2018). We selected the 8 genotypes used in this experiment to encompass the range of trait values determined for this population of eelgrass measured when the common garden was experiencing marine heatwave conditions (DuBois et al., 2019). We assigned ten pots -- two unique polyculture combinations and each of the eight monocultures -- to each of ten mesocosms, with five mesocosms per temperature treatment (see DuBois et al. 2020 for a diagram of the experimental set up). All mesocosms received sand-filtered flow-through seawater at a rate of approximately 0.8-1.0 liters per minute (L min -1 ). We allowed the plants to acclimate for one month prior to initiating the temperature treatments. We maintained an ambient temperature treatment by cooling flow-through seawater in a head tank by approximately 1˚C using an Aqua Logic Delta Star in-line titanium chiller. Seawater in the elevated temperature treatment was raised approximately 3˚C above the ambient treatment in a separate header tank using Process Technologies titanium immersion heaters. This level of warming mimicked the 2014 and 2015 extreme warming events in the Northern Pacific, where the mass of unusually warm water called “The Blob” raised summer ocean temperatures three standard deviations above the long-term average (Sanford et al., 2019). At the end of the experiment (10 weeks), we estimated lesion percent cover of the third rank leaf of the terminal shoot of each transplant (i.e., focal leaf) to measure the signs of wasting disease (Burdick et al., 1993). We recorded lesions as either absent, <1%, <10%, or ≥10% cover. When lesions were ≥10% cover, we also recorded a numerical estimate of lesion percent cover. We then collected and preserved the top half of the focal leaf in individual plastic bags sealed with 30 milliliters of silica (Flower Drying Art Silica Gel; Activa) for subsequent DNA extraction and quantitative PCR to estimate Labyrinthula zosterae cells as a proxy for infection (Bergmann et al., 2011; Bockelmann et al., 2013; Groner et al., 2021). At one-month intervals over the course of the experiment, we measured leaf growth rate of the terminal shoot of each transplant using the “hole-punch” method (Williams and Ruckelshaus, 1993). Labyrinthula zosterae infection can be affected by plant defenses (Steele et al., 2005; Trevathan-Tackett et al., 2015) and these defenses may trade off with plant growth rate, resulting in a positive relationship between growth rate and infection. Alternatively, L. zosterae infection can result in reduced leaf growth rate (Graham et al., 2021), leading to a negative relationship. L. zosterae prevalence can also be affected by plant size (Groner et al., 2016), due to greater leaf-to-leaf contact and resulting increased parasite transmission (Muehlstein, 1992), so we measured the length of the focal leaf of each transplant at the end of the experiment. Labyrinthula zosterae DNA extraction and quantitative PCR Assay We extracted L. zosterae DNA from dried leaf tissue using Omega Bio-Tek E.Z. Tissue DNA extraction kits at the Northeastern University Marine Science Center in Nahant, MA. For each sample, we separated the dried leaf tissue into 2-16 mg subsamples and homogenized the tissue in a ball mill (Retsch, Germany) at a frequency of 30 Hz for 5 min (Bockelmann et al. 2013). We lysed ground subsamples individually following the manufacturer’s instructions and added 1 microliter of 500 ng per microliter (ng*uL -1 ) salmon sperm DNA solution (Invitrogen, USA) to the first subsample of each sample immediately before recombining all subsamples in the spin columns. Salmon sperm DNA was added to enhance extraction efficiency and ensure that even low amounts of target DNA are carried through the filter absorption steps (Bockelmann et al., 2013). We eluted all DNA extractions into 100 uL. Following elution, we used Zymo OneStep-96 PCR Inhibitor Removal kits to clean 50 uL sub-samples of each DNA extraction following the manufacturers instructions. We stored cleaned DNA extractions at -20˚C prior to quantitative PCR. We used a TaqMan quantitative PCR (qPCR) assay with a forward primer: TTGAACGTAACATT-CGACTTTCGT, reverse primer: ACGCATGAAGCGGTCTTCTT, and MBG probe: TGGACGAGTGTGTTTTG that carries the fluorescence label 6-Fam at the 5’ end and the dark quencher FHQ at the 3’ end (Bio-Rad, USA) developed specifically for L. zosterae (Bockelmann et al., 2013, Bergmann et al., 2011). We made up qPCR reactions to a 10 uL reaction volume using standard conditions recommended by the manufacturer: 5 uL SsoAdvanced TM Universal Probes Supermix 2x (Bio-Rad, USA), 1 uL template DNA, 0.4 uL 4:1 Primer:Probe Mix (final concentrations of 400 nM forward primer, 400 nM reverse primer, 100 nM probe), and 3.6 uL Milli-Q H 2 O (Thermofisher, USA). Reactions were run on a CFX96 Real-Time System (Bio-Rad, USA) using the following thermo-cycling program: 3 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. We tested all samples in duplicate and if replicates differed by greater than one cycle threshold (Ct), reactions were rerun in triplicate. We only used the data from reactions in analyses when replicates fell within one Ct. Our lowest detection was 1.76 copies per reaction or 0.15 cells per extraction. We ran each 96-well plate of qPCR reactions with a set of nine standards: a dilution series of gBlock Gene Fragments (Integrated DNA Technologies, USA) designed based on the highly conserved sequence of the 5.8s ribosomal RNA gene of L. zosterae known as internal transcribed spacer 1 (ITS) targeted by the TaqMan qPCR assay; an L. zosterae cell standard consisting of a sample of DNA extracted from a know quantity of pathogenic L. zosterae cells; and an inhibition control consisting of a half volume of L. zosterae cell standard and a half volume of a haphazardly selected sample. We ran a total of 31 96-well plates of qPCR reactions with a mean efficiency of 97.4% ± 4.3 and R 2 0.996 ± 0.004. To convert Ct values to L. zosterae cell numbers, four equations were used. The equations and details are captured in the Supplemental Files section of this metadata within the file titled, "Equations for conversion of Ct values to Labyrinthula zosterae cell numbers." We used a pure culture of the pathogenic L. zosterae isolate 316b provided by D. Martin in 2015 to make our L. zosterae cell standard (Martin et al., 2016; GenBank: KU559372.1). We cultured L. zosterae cells on serum seawater agar media (Muehlstein et al., 1991). We scraped cells from an actively growing edge of L. zosterae culture into serum seawater liquid media (D. Martin pers. com.). We mixed the liquid media + L. zosterae cell slurry vigorously on a bench top vortex for 30 sec and aliquoted immediately into three replicate subsamples for cell counts and extraction. In order to break up cell clumps for ease of counting, we added Tween80 (Sigma-Aldrich, USA) to a final concentration of 1:100 into the two subsamples used for cell counts, and mixed for 30 sec. We counted cells of four replicate aliquots per subsample on a hemocytometer. We calculated cell concentration by averaging over all replicates. Prior to DNA extraction, we centrifuged the third replicate L. zosterae cell solution at 6,000 g for 10 min and drew off the supernatant without disturbing the cell pellet. We then added a ~4 mg section of dried healthy Zostera. marina tissue to the cell pellet to account for possible interference of Zostera marina compounds in the extraction process. To extract L. zosterae DNA, we followed the DNA extraction and inhibitor removal protocols outlined above. We designed the gBlock double stranded DNA fragments (Integrated DNA Technologies, USA) using published sequences of the ITS region of the L. zosterae genome (GenBank: JN121409-13). 5’-CTGTGATCTCTGAAAATACTTGTTT (1) TTGAACGTAACATTCGACTTTCGT CGATT TTG (2) TGGACGAGTGTGTTTTGT AAACCTACCC (3) AAGAAGACCGCTTCATGCGT GTCGCTGACTAATGAAACAAACAAA-3’ The gBlock fragment sequences were a total length of 130 bp (base pairs), which included target regions for the forward (1) and reverse (3) primers and the MGD probe (2), underlined above, as well as 25 base pairs of additional sequence on both the 5’ and 3’ ends to increase fragment stability. We diluted gBlock fragments in Milli-Q H 2 O (Thermofisher, USA) to seven concentrations: 2.24e 1 , 1.12e 2 , 5.61e 2 , 2.81e 3 , 1.40e 4 , 7.02e 4 , 7.02e 5 copies/µL and included this dilution series in each qPCR run as a standard curve (Bergmann et al., 2011). The range of the gBlock dilution curve: approx. 1-60,000 cells/extraction encompassed the range of most L. zosterae values observed in our samples: 0.15-450,000 cells/extraction or 1.84e 2 -5.52e 8 copies/extraction. Life Sciences Identifiers (LSID) for taxonomic names: Zostera marina (urn:lsid:marinespecies.org:taxname:145795) Labyrinthula zosterae (urn:lsid:marinespecies.org:taxname:395093) Labyrinthula (urn:lsid:marinespecies.org:taxname:119090)
        purpose:  This dataset is available to the public for a wide variety of uses including scientific research and analysis.
        credit:
          Anchor:  https://www.nsf.gov/awardsearch/showAward?AWD_ID=1652320 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1652320 Award URL: http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1652320
        status:  (MD_ProgressCode) completed
        status:  (MD_ProgressCode) historicalArchive
        pointOfContact:  (CI_ResponsibleParty)
            organisationName:
              Anchor:  https://ror.org/04r0wrp59 NOAA National Centers for Environmental Information
            contactInfo:  (CI_Contact)
                address:  (CI_Address)
                    electronicMailAddress:  ncei.info@noaa.gov
                onlineResource:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/contact
                    protocol:  HTTPS
                    name:  NCEI Contact Information
                    description:  Information for contacts at NCEI.
                    function:  (CI_OnLineFunctionCode) information
            role:  (CI_RoleCode) pointOfContact
        resourceMaintenance:  (MD_MaintenanceInformation)
            maintenanceAndUpdateFrequency:  (MD_MaintenanceFrequencyCode) asNeeded
        graphicOverview:  (MD_BrowseGraphic)
            fileName: https://www.ncei.noaa.gov/access/metadata/landing-page/bin/gfx?id=gov.noaa.nodc:0291617
            fileDescription:  Preview graphic
            fileType:  PNG
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/accession/0291617 0291617
            thesaurusName:  (CI_Citation)
                title:  NCEI ACCESSION NUMBER
                date:  (CI_Date)
                    date:  2022-11-22
                    dateType:  (CI_DateTypeCode) publication
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/datatype/details/534 growth rate
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/datatype/details/172 INCUBATION - TEMPERATURE
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  NODC DATA TYPES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/insttype/details/182 PCR machine
            type:  (MD_KeywordTypeCode) instrument
            thesaurusName:  (CI_Citation)
                title:  NODC INSTRUMENT TYPES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/obstype/details/2 biological
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  NODC OBSERVATION TYPES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  NODC COLLECTING INSTITUTION NAMES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1416 Biological and Chemical Oceanography Data Management Office
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  NODC SUBMITTING INSTITUTION NAMES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:  oceanography
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  WMO_CategoryCode
                date:  (CI_Date)
                    date:  2012-09-15
                    dateType:  (CI_DateTypeCode) publication
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://gcmd.earthdata.nasa.gov/kms/concept/13afda36-ea44-427c-a297-1fe58083b8f0 BCO-DMO > Biological and Chemical Oceanography Data Management Office
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  Global Change Master Directory (GCMD) Data Center Keywords
                date:  (CI_Date)
                    date:  2025
                    dateType:  (CI_DateTypeCode) revision
                edition:  21
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA)
                    contactInfo:  (CI_Contact)
                        address:  (CI_Address)
                            city:  Greenbelt
                            administrativeArea:  MD
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://forum.earthdata.nasa.gov/app.php/tag/GCMD%2BKeywords
                            protocol:  HTTPS
                            name:  GCMD Keyword Forum Page
                            description:  Global Change Master Directory (GCMD). 2025. GCMD Keywords, Version 21. Greenbelt, MD: Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA). URL (GCMD Keyword Forum Page): https://forum.earthdata.nasa.gov/app.php/tag/GCMD+Keywords
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) custodian
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/project/709942 CAREER: Linking genetic diversity, population density, and disease prevalence in seagrass and oyster ecosystems (Seagrass and Oyster Ecosystems)
            type:  (MD_KeywordTypeCode) project
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Projects
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1652320 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1652320
            type:  (MD_KeywordTypeCode) project
            thesaurusName:  (CI_Citation)
                title:  Funding Award Information
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/514901 cell_concentration
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1070 date
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1730 flag
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/512798 growth
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/730 latitude
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1097 length
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/731 longitude
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/886 mass
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/639488 percent coverage
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/960 sample identification
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1742 sample type
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1992 tank
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/541490 temp_incub
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/489066 treatment
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Parameters
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881991 bin
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882005 cells
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882003 cells_per_extraction
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882004 cells_per_mg
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881994 diversity
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881990 end_date
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881996 genotype
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881998 growth_rate
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882006 latitude
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881997 length
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881999 lesion
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882001 lesion_cover
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882000 lesion_group
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882007 longitude
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/882002 mass
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881992 pot
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881993 shoot
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881989 start_date
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/881995 temperature
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  Originator Parameter Names
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/711 Aquarium
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522982 Aquarium chiller
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522984 Homogenizer
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522981 Immersion heater
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/707569 qPCR Thermal Cycler
            type:  (MD_KeywordTypeCode) instrument
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Instruments
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522982 Aqua Logic Delta Star in-line titanium chiller
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/707569 Bio-Rad CFX96 Real-Time System
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522981 Process Technologies titanium immersion heater
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/522984 Retsch Mixer Mill 400
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/711 flow through tanks
            type:  (MD_KeywordTypeCode) instrument
            thesaurusName:  (CI_Citation)
                title:  Originator Instruments
                date: (inapplicable)
        resourceConstraints:  (MD_Constraints)
            useLimitation:  accessLevel: Public
        resourceConstraints:  (MD_LegalConstraints)
            useConstraints:  (MD_RestrictionCode) otherRestrictions
            otherConstraints:  Cite as: Hughes, A. Randall; DuBois, Katherine; Kardish, Melissa; Schenck, Forest; Stachowicz, John J. (2024). Seagrass metrics from seagrass wasting disease mesocosm experiments conducted at Bodega Marine Laboratory from July-September 2015 (NCEI Accession 0291617). https://www.ncei.noaa.gov/archive/accession/0291617. In Biological and Chemical Oceanography Data Management Office (BCO-DMO). Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/BCO-DMO. Accessed [date].
        resourceConstraints:  (MD_LegalConstraints)
            useLimitation:  Distribution liability: NOAA and NCEI make no warranty, expressed or implied, regarding these data, nor does the fact of distribution constitute such a warranty. NOAA and NCEI cannot assume liability for any damages caused by any errors or omissions in these data. If appropriate, NCEI can only certify that the data it distributes are an authentic copy of the records that were accepted for inclusion in the NCEI archives.
        resourceConstraints:  (MD_LegalConstraints)
            accessConstraints:  (MD_RestrictionCode) otherRestrictions
            otherConstraints:  Use liability: NOAA and NCEI cannot provide any warranty as to the accuracy, reliability, or completeness of furnished data. Users assume responsibility to determine the usability of these data. The user is responsible for the results of any application of this data for other than its intended purpose.
        resourceConstraints:  (MD_LegalConstraints)
            useConstraints:  (MD_RestrictionCode) license
            otherConstraints:
              Anchor:  CC-BY-4.0 This dataset is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) License.
            otherConstraints:
              Anchor:  CC-BY-4.0 SPDX License: Creative Commons Attribution 4.0 International (CC-BY-4.0)
        aggregationInfo:  (MD_AggregateInformation)
            aggregateDataSetName:  (CI_Citation)
                title:  Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                date:  (CI_Date)
                    date:  2009-12-01
                    dateType:  (CI_DateTypeCode) publication
                identifier:  (MD_Identifier)
                    code: https://www.ncei.noaa.gov/archive/accession/BCO-DMO
                citedResponsibleParty:  (CI_ResponsibleParty)
                    positionName: (unknown)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://www.ncei.noaa.gov/archive/accession/BCO-DMO
                            protocol:  HTTPS
                            name: https://www.ncei.noaa.gov/archive/accession/BCO-DMO
                            description:  NCEI Collection
                            function:  (CI_OnLineFunctionCode) information
                    role: (unknown)
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  NOAA National Centers for Environmental Information
                    role:  (CI_RoleCode) publisher
            associationType:  (DS_AssociationTypeCode) largerWorkCitation
            initiativeType:  (DS_InitiativeTypeCode) collection
        aggregationInfo:  (MD_AggregateInformation)
            aggregateDataSetName:  (CI_Citation)
                title:  Schenck, F., DuBois, K., Kardish, M., Stachowicz, J. J., Hughes, A. R. (2022) Seagrass metrics from from seagrass wasting disease mesocosm experiments conducted at Bodega Marine Laboratory from July-September 2015. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2022-10-06. https://doi.org/10.26008/1912/bco-dmo.879749.1
                date:  (CI_Date)
                    date:  2022-10-06
                    dateType:  (CI_DateTypeCode) publication
                identifier:  (MD_Identifier)
                    authority:  (CI_Citation)
                        title:  International DOI Foundation (IDF)
                        date: (inapplicable)
                    code: https://doi.org/10.26008/1912/bco-dmo.879749.1
                citedResponsibleParty:  (CI_ResponsibleParty)
                    positionName: (unknown)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://doi.org/10.26008/1912/bco-dmo.879749.1
                            protocol:  HTTPS
                            name: https://doi.org/10.26008/1912/bco-dmo.879749.1
                            description:  originator dataset
                            function:  (CI_OnLineFunctionCode) download
                    role: (unknown)
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  A. Randall Hughes
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/522929
                            protocol:  HTTP
                            name:  Northeastern University website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Katherine DuBois
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/881979
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Melissa Kardish
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/881977
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Forest Schenck
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/851053
                            protocol:  HTTP
                            name:  Northeastern University website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  John J. Stachowicz
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California - Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/518660
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/affiliation/191
                            protocol:  HTTP
                            name:  website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) pointOfContact
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Hughes, A. Randall
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/522929
                            protocol:  HTTP
                            name:  Northeastern University website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  DuBois, Katherine
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California-Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/881979
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Kardish, Melissa
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California-Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/881977
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Schenck, Forest
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1894 Northeastern University
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/851053
                            protocol:  HTTP
                            name:  Northeastern University website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:  Stachowicz, John J.
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1445 University of California-Davis
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/518660
                            protocol:  HTTP
                            name:  University of California - Davis website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:
                      Anchor:  https://ror.org/00vcb3m70 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://bcodmo.org
                            protocol:  HTTP
                            name:  Biological and Chemical Oceanography Data Management Office (BCO-DMO) website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) publisher
                presentationForm:  (CI_PresentationFormCode) tableDigital
            associationType:  (DS_AssociationTypeCode) crossReference
            initiativeType:  (DS_InitiativeTypeCode) collection
        language:
          LanguageCode:  eng; USA
        characterSet:  (MD_CharacterSetCode) utf8
        topicCategory:  (MD_TopicCategoryCode) environment
        topicCategory:  (MD_TopicCategoryCode) oceans
        extent:  (EX_Extent)
            geographicElement:  (EX_GeographicBoundingBox)
                westBoundLongitude:  -123.066
                eastBoundLongitude:  -123.066
                southBoundLatitude:  38.318
                northBoundLatitude:  38.318
            temporalElement:  (EX_TemporalExtent)
                extent:
                  TimePeriod:
                    beginPosition:  2015-07-01
                    endPosition:  2015-09-14
        supplementalInformation: (missing)
return to top
    distributionInfo:  (MD_Distribution)
        distributor:  (MD_Distributor)
            distributorContact:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://ror.org/04r0wrp59 NOAA National Centers for Environmental Information
                contactInfo:  (CI_Contact)
                    phone:  (CI_Telephone)
                        voice:  +1-301-713-3277
                    address:  (CI_Address)
                        electronicMailAddress:  ncei.info@noaa.gov
                role:  (CI_RoleCode) pointOfContact
            distributionOrderProcess:  (MD_StandardOrderProcess)
                fees:  In most cases, electronic downloads of the data are free. However, fees may apply for custom orders, data certifications, copies of analog materials, and data distribution on physical media.
                orderingInstructions:  Contact NCEI for other distribution options and instructions.
            distributorFormat:  (MD_Format)
                name:  TSV
                version: (unknown)
            distributorTransferOptions:  (MD_DigitalTransferOptions)
                transferSize:
                  Real:  0.608
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/0291617
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  NCEI Dataset Landing Page
                    description:  Navigate directly to the URL for a descriptive web page with download links.
                    function:  (CI_OnLineFunctionCode) information
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/oas/291617
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  Descriptive Information
                    description:  Navigate directly to the URL for a descriptive web page with download links.
                    function:  (CI_OnLineFunctionCode) information
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/download/291617
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  HTTPS
                    description:  Navigate directly to the URL for data access and direct download.
                    function:  (CI_OnLineFunctionCode) download
                onLine:  (CI_OnlineResource)
                    linkage: ftp://ftp-oceans.ncei.noaa.gov/nodc/archive/arc0227/0291617/
                    protocol:  FTP
                    applicationProfile:  Any FTP client
                    name:  FTP
                    description:  These data are available through the File Transfer Protocol (FTP). FTP is no longer supported by most internet browsers. You may copy and paste the FTP link to the data into an FTP client (e.g., FileZilla or WinSCP).
                    function:  (CI_OnLineFunctionCode) download
return to top
    dataQualityInfo:  (DQ_DataQuality)
        scope:  (DQ_Scope)
            level:  (MD_ScopeCode) dataset
        lineage:  (LI_Lineage)
            processStep:  (LE_ProcessStep)
                description:  NCEI Accession 0291617 v1.1 was published.
                dateTime:
                  DateTime:  2024-04-21T21:58:37Z
                output:  (LE_Source)
                    sourceCitation:  (CI_Citation)
                        title:  NCEI Accession 0291617 v1.1
                        date:  (CI_Date)
                            date: (inapplicable)
                            dateType:  (CI_DateTypeCode) publication
                        citedResponsibleParty:  (CI_ResponsibleParty)
                            individualName: (inapplicable)
                            contactInfo:  (CI_Contact)
                                onlineResource:  (CI_OnlineResource)
                                    linkage: https://www.ncei.noaa.gov/archive/accession/0291617/1.1
                                    protocol:  HTTPS
                                    name:  NCEI Accession 0291617 v1.1
                                    description:  published 2024-04-21T21:58:37Z
                                    function:  (CI_OnLineFunctionCode) download
                            role: (inapplicable)
return to top
    metadataMaintenance:  (MD_MaintenanceInformation)
        maintenanceAndUpdateFrequency:  (MD_MaintenanceFrequencyCode) asNeeded
        maintenanceNote:  Metadata are developed, maintained and distributed by NCEI. Updates are performed as needed to maintain currentness.
        contact:  (CI_ResponsibleParty)
            organisationName:  NOAA National Centers for Environmental Information
            role:  (CI_RoleCode) custodian
return to top
    acquisitionInformation:  (MI_AcquisitionInformation)
        instrument:  (MI_Instrument)
            identifier:  (MD_Identifier)
                code:  PCR machine
            type:  PCR machine
            description:  thermal cycler, thermocycler, PCR machine, DNA amplifier The thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier) is a laboratory apparatus most commonly used to amplify segments of DNA via the polymerase chain reaction (PCR). https://en.wikipedia.org/wiki/Thermal_cycler, 2017-05-02.