Skip to main content

Amplicon sequence variants (ASVs) recovered from samples and their related identification as Pseudo-nitzschia taxa and the methods used from 2016-09-26 to 2019-11-25 (NCEI Accession 0278248)


 (MI_Metadata)
    fileIdentifier:  gov.noaa.nodc:0278248
    language:
      LanguageCode:  eng
    characterSet:  (MD_CharacterSetCode) utf8
    parentIdentifier:  gov.noaa.nodc:BCO-DMO
    hierarchyLevel:  (MD_ScopeCode) dataset
    hierarchyLevelName:  granule
    contact:  (CI_ResponsibleParty)
        organisationName:  NOAA National Centers for Environmental Information
        contactInfo:  (CI_Contact)
            address:  (CI_Address)
                electronicMailAddress:  ncei.info@noaa.gov
            onlineResource:  (CI_OnlineResource)
                linkage: https://www.ncei.noaa.gov/contact
                protocol:  HTTPS
                name:  NOAA Contact Information
                description:  Information for contacts at NCEI.
                function:  (CI_OnLineFunctionCode) information
        role:  (CI_RoleCode) custodian
    dateStamp:
      DateTime:  2024-05-31T15:15:37Z
    metadataStandardName:  ISO 19115-2 Geographic Information - Metadata - Part 2: Extensions for Imagery and Gridded Data
    metadataStandardVersion:  ISO 19115-2:2009(E)
return to top
    identificationInfo:  (MD_DataIdentification)
        citation:  (CI_Citation)
            title:  Amplicon sequence variants (ASVs) recovered from samples and their related identification as Pseudo-nitzschia taxa and the methods used from 2016-09-26 to 2019-11-25 (NCEI Accession 0278248)
            date:  (CI_Date)
                date:  2023-05-15
                dateType:  (CI_DateTypeCode) publication
            edition: (inapplicable)
            identifier:  (MD_Identifier)
                authority:  (CI_Citation)
                    title:  NOAA National Centers for Environmental Information
                    date: (inapplicable)
                code:
                  Anchor:  NCEI Dataset ID gov.noaa.nodc:0278248
            identifier:  (MD_Identifier)
                authority:  (CI_Citation)
                    title:  NCEI Archive Management System
                    date: (inapplicable)
                code:
                  Anchor:  NCEI Accession ID 0278248
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1730 NOAA National Centers for Environmental Information
                contactInfo:  (CI_Contact)
                    address:  (CI_Address)
                        electronicMailAddress:  ncei.info@noaa.gov
                    onlineResource:  (CI_OnlineResource)
                        linkage: https://www.ncei.noaa.gov/contact
                        protocol:  HTTPS
                        name:  NCEI Contact Information
                        description:  Information for contacts at NCEI.
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) publisher
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1416 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://bcodmo.org
                        protocol:  HTTP
                        name:  Biological and Chemical Oceanography Data Management Office website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) resourceProvider
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:
                  Anchor:  http://lod.bco-dmo.org/id/person/558172 Bethany D. Jenkins
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island (URI)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/558172
                        protocol:  HTTP
                        name:  University of Rhode Island website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:
                  Anchor:  http://lod.bco-dmo.org/id/person/839239 Matthew Bertin
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island (URI)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/839239
                        protocol:  HTTP
                        name:  University of Rhode Island website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) principalInvestigator
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  http://lod.bco-dmo.org/id/affiliation/191 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/affiliation/191
                        protocol:  HTTP
                        name:  website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) pointOfContact
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:
                  Anchor:  http://lod.bco-dmo.org/id/person/558172 Jenkins, Bethany D.
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 University of Rhode Island
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/558172
                        protocol:  HTTP
                        name:  University of Rhode Island website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                individualName:
                  Anchor:  http://lod.bco-dmo.org/id/person/839239 Bertin, Matthew
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 University of Rhode Island
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://lod.bco-dmo.org/id/person/839239
                        protocol:  HTTP
                        name:  University of Rhode Island website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) author
            citedResponsibleParty:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island (URI)
                contactInfo:  (CI_Contact)
                    onlineResource:  (CI_OnlineResource)
                        linkage: http://ww2.uri.edu/
                        protocol:  HTTP
                        name:  University of Rhode Island website
                        description:  Institution web page
                        function:  (CI_OnLineFunctionCode) information
                role:  (CI_RoleCode) contributor
            presentationForm:  (CI_PresentationFormCode) tableDigital
        abstract:  This dataset contains biological and survey - biological data collected on R/V Endeavor during cruises EN608, EN617, EN627, and EN644 from 2016-09-26 to 2019-11-25. These data include species. The instruments used to collect these data include Automated DNA Sequencer. These data were collected by Bethany D. Jenkins and Matthew Bertin of University of Rhode Island as part of the "RII Track-1: Rhode Island Consortium for Coastal Ecology Assessment, Innovation, and Modeling (C-AIM)" project. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) submitted these data to NCEI on 2021-04-29. The following is the text of the dataset description provided by BCO-DMO: Pseudo-nitzschia asv Dataset Description: Acquisition Description: For most samples, plankton biomass for Pseudo-nitzschia DNA identification was collected by passing an average of 270 mL of surface seawater with a peristaltic pump across a 25 mm 5.0 mm polyester membrane filter (Sterlitech, Kent, WA, USA). Widths of some Pseudo-nitzschia spp. are < 5.0 mm (Lelong et al. 2012), but this size pore likely captured horizontally orientated cells and chains of cells, and was consistent with pore size used to examine toxicity. Filters were flash frozen in liquid nitrogen and stored at -80 °C until extraction. DNA was extracted using a modified version of the DNeasy Plant DNA extraction kit (Qiagen, Germantown, MD, USA) with an added bead beating step for 1 minute and QIA-Shredder column (Qiagen, Germantown, MD, USA) as reported in Chappell et al. 2019. Additionally, DNA was eluted in 30 µL with a second elution step of either 30 or 15 µL to maximize DNA yield. DNA was assessed for quality with a Nanodrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) and quantified using a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA) with the Broad Range dsDNA and High Sensitivity dsDNA kits (Thermo Fisher Scientific Inc., Waltham, MA, USA). DNA yields reported by the Qubit ranged from below the limit of detection to 26.5, with an average of 2.0 ng DNA / mL eluent. Long-Term Plankton Time Series (LTPTS) samples from October 2016 and March 2017 had an average of 300 mL surface seawater passed over a 25 mm 0.2 mm filter, were extracted following existing LTPTS methods of DNA extraction using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA) with an added bead beating step (Canesi and Rynearson 2016), and yielded average 0.9 ng DNA / mL eluent as measured by the Qubit. Net tow samples had 50 mL of concentrate was passed across a 0.22 µm pore size Sterivex filter unit (MilliporeSigma, Burlington, MA, USA), and were extracted with the same modified DNeasy Plant DNA extraction protocol as above, with 4x volumes of AP1 buffer and RNase A and beads added to the unit to account for the larger sample surface area, extraction occurring within the capped unit itself to maximize yield, and then the lysate removed with a sterile syringe and subsequent steps with adjusted volumes as appropriate. As expected, DNA yields were higher from the Sterivex units ranging from 2.4 – 54.0 ng DNA / mL eluent with an average of 13.7 ng DNA/ mL elution as measured by the Qubit. For the March 13, 2017 NBay samples, 125 mL of surface seawater was passed across a HV filter and extracted with the DNeasy Plant DNA extraction kit with scissors and no beads. As measured by the Qubit, the average DNA yield was 3.7 ng DNA / mL eluent. A negative control sample was prepared of a blank 25 mm 5.0 mm polyester membrane filter using extraction reagents which had no detectable DNA using the Qubit. There were two positive controls of mock communities comprised of two known Pseudo-nitzschia species from monocultures. The two Pseudo-nitzschia cultures were P. subcurvata collected from the Southern Ocean and P. pungens isolated from NBay (provided by J. Rines). One positive control was made by combining equal concentrations of extracted DNA with 1.0 ng DNA of each culture. The second positive control was created of equal cell abundance estimated to be captured onto the filters of the cultures prior to extraction. These negative and positive controls were prepared for sequencing and sequenced on the same plate as the other environmental samples. The ITS1 has been targeted for amplification and analysis by ARISA previously for Pseudo-nitzschia identification in environmental samples (Hubbard, Rocap, and Armbrust 2008). A comparison of ITS1 appears to be much less conserved and is divergent enough across Pseudo-nitzschia that 41 different species can be identified using existing public sequencing data. The primers to target the ITS1 region of Pseudo-nitzschia used this existing forward primer sequence of the ITS1 region for eukaryotes: TCCGTAGGTGAACCTGCGG (White et al. 1990) and a custom reverse primer designed using 132 Pseudo-nitzschia ITS1 sequences from the NCBI nucleotide database (downloaded on 4/3/2019) from this nucleotide search: ((Pseudo-nitzschia[Organism]) AND internal transcribed spacer[Title]) NOT uncultured): CATCCACCGCTGAAAGTTGTAA. This reverse primer targets a conserved region in the 5.8S. All primer sequences are reported from 5’ – 3’. MiSeq adapter sequences were added to the beginning of the primer sequences for these full sequences used in this study: forward primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCGTAGGTGAACCTGCGG and reverse primer GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATCCACCGCTGAAAGTTGTAA. When checking the specificity of these primers using the NCBI nt database, it became known that sequences beyond Pseudo-nitzschia would also be amplified in this study including other diatoms and dinoflagellates; however, the large number of sequencing reads recovered on the MiSeq platform would circumvent this non-specific characteristic of the primers. The accession numbers of the sequences used in this primer design are reported in Table S2 of Sterling et al. (in prep), along with a summary of Pseudo-nitzschia species expected to amplify with these based on the in silico design. The expected ranges for PCR products were from 235 – 370 bp as the size of the ITS1 region differs for some Pseudo-nitzschia taxa. Primers (Integrated DNA Technologies, Coralville, IA, USA) were HPLC purified, resuspended in 1x Tris-Acetate-EDTA (TAE) buffer, and then working stocks created in diethylpyrocarbonate (DEPC)-treated H2O. About 4 ng of extracted DNA was used for each PCR reaction. If, according to the Qubit quantification, the DNA concentration was less than 2 ng mL-1 or below the limit of detection, it was then used as is, and just 2 mL was added to the PCR reaction. PCR reactions were set up on ice, in a 1x reaction in 25 mL total volume. Final primer concentration was 0.5 mM and polymerase was Phusion Hot Start High-Fidelity Master Mix (Thermo Fisher Scientific Inc., Waltham, MA, USA). There were two cycles with different annealing temperatures, the first with an annealing temperature specific to the loci-specific region and the second set of cycles with an annealing temperature that also takes the MiSeq adapter sequence into account (Canesi and Rynearson 2016). PCR conditions used were initial denaturation for 30 seconds at 98 °C, 15 cycles of the following: denaturation for 10 seconds at 98 °C, annealing for 30 seconds at 64.1 °C , extension for 30 seconds at 72 °C, and 15 cycles with the same conditions except a higher annealing temperature of 72 °C , and then a final extension for 10 minutes at 72 °C , and a holding temperature of 10 °C until stored in the -20 °C freezer. PCR products were visualized on a 1% agarose gel before submission to the URI Genomics and Sequencing Center (Kingston, RI, USA) where library preparation and sequencing were performed on a 2x300 bp MiSeq run (Illumina, Inc., San Diego, CA, USA). There were 193 environmental samples were sequenced, along with two positive controls of Pseudo-nitzschia DNA from cultures and one negative control, for a total of 196 samples using two sets of MiSeq indices on the same sequencing plate. It was deemed appropriate to multiplex this plate as estimated read depth to recover Pseudo-nitzschia sequences was predicted to be lower than usual.
        purpose:  This dataset is available to the public for a wide variety of uses including scientific research and analysis.
        credit:
          Anchor:  https://www.nsf.gov/awardsearch/showAward?AWD_ID=1655686 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1655686 Award URL: http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1655686
        credit:
          Anchor:  https://www.nsf.gov/awardsearch/showAward?AWD_ID=1655221 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OIA-1655221 Award URL: http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1655221
        credit:  Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA18OAR4170094
        credit:  Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA14OAR4170082
        status:  (MD_ProgressCode) completed
        status:  (MD_ProgressCode) historicalArchive
        pointOfContact:  (CI_ResponsibleParty)
            organisationName:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1730 NOAA National Centers for Environmental Information
            contactInfo:  (CI_Contact)
                address:  (CI_Address)
                    electronicMailAddress:  ncei.info@noaa.gov
                onlineResource:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/contact
                    protocol:  HTTPS
                    name:  NCEI Contact Information
                    description:  Information for contacts at NCEI.
                    function:  (CI_OnLineFunctionCode) information
            role:  (CI_RoleCode) pointOfContact
        resourceMaintenance:  (MD_MaintenanceInformation)
            maintenanceAndUpdateFrequency:  (MD_MaintenanceFrequencyCode) asNeeded
        graphicOverview:  (MD_BrowseGraphic)
            fileName: https://www.ncei.noaa.gov/access/metadata/landing-page/bin/gfx?id=gov.noaa.nodc:0278248
            fileDescription:  Graphic not available.
            fileType:  PNG
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/accession/0278248 0278248
            thesaurusName:  (CI_Citation)
                title:  NCEI ACCESSION NUMBER
                date:  (CI_Date)
                    date:  2021-04-29
                    dateType:  (CI_DateTypeCode) publication
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/datatype/details/339 SPECIES IDENTIFICATION
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  NODC DATA TYPES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/obstype/details/2 biological
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/obstype/details/33 survey - biological
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  NODC OBSERVATION TYPES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/platform/details/2843 ENDEAVOR
            type:  (MD_KeywordTypeCode) platform
            thesaurusName:  (CI_Citation)
                title:  NODC PLATFORM NAMES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  NODC COLLECTING INSTITUTION NAMES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1416 Biological and Chemical Oceanography Data Management Office
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  NODC SUBMITTING INSTITUTION NAMES THESAURUS
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:  oceanography
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  WMO_CategoryCode
                date:  (CI_Date)
                    date:  2012-09-15
                    dateType:  (CI_DateTypeCode) publication
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://gcmd.earthdata.nasa.gov/kms/concept/13afda36-ea44-427c-a297-1fe58083b8f0 BCO-DMO > Biological and Chemical Oceanography Data Management Office
            type:  (MD_KeywordTypeCode) dataCentre
            thesaurusName:  (CI_Citation)
                title:  Global Change Master Directory (GCMD) Data Center Keywords
                date:  (CI_Date)
                    date:  2024
                    dateType:  (CI_DateTypeCode) revision
                edition:  19
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA)
                    contactInfo:  (CI_Contact)
                        address:  (CI_Address)
                            city:  Greenbelt
                            administrativeArea:  MD
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://forum.earthdata.nasa.gov/app.php/tag/GCMD%2BKeywords
                            protocol:  HTTPS
                            name:  GCMD Keyword Forum Page
                            description:  Global Change Master Directory (GCMD). 2024. GCMD Keywords, Version 19. Greenbelt, MD: Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA). URL (GCMD Keyword Forum Page): https://forum.earthdata.nasa.gov/app.php/tag/GCMD+Keywords
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) custodian
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/project/836631 RII Track-1: Rhode Island Consortium for Coastal Ecology Assessment, Innovation, and Modeling (C-AIM)
            type:  (MD_KeywordTypeCode) project
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Projects
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/deployment/848016 EN608
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/deployment/848018 EN617
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/deployment/848056 EN627
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/deployment/848020 EN644
            type:  (MD_KeywordTypeCode) project
            thesaurusName:  (CI_Citation)
                title:  Provider Cruise IDs
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1655686 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OCE-1655686
            keyword:
              Anchor:  http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1655221 Funding provided by NSF Division of Ocean Sciences (NSF OCE) Award Number: OIA-1655221
            keyword:  Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA14OAR4170082
            keyword:  Funding provided by National Oceanic and Atmospheric Administration (NOAA) Award Number: NA18OAR4170094
            type:  (MD_KeywordTypeCode) project
            thesaurusName:  (CI_Citation)
                title:  Provider Funding Award Information
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1971 accession number
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/778 comments
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1073 no standard parameter
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/960 sample identification
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/1868 sampling_method
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/684377 sequence
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/parameter/976 species
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Parameters
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847714 ASV_Number_on_Sterling_et_al_Figures
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847715 ID_Method
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847712 NCBI_GenBank_Accession_Number
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847717 Notes
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847713 Pseudo_nitzschia_species
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847710 Sequence_ID
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847711 Sequence_of_ASV
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/dataset-parameter/847716 Threshold_Pass
            type:  (MD_KeywordTypeCode) theme
            thesaurusName:  (CI_Citation)
                title:  Originator Parameter Names
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/649 Automated DNA Sequencer
            type:  (MD_KeywordTypeCode) instrument
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Standard Instruments
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/instrument/649 Illumina MiSeq Next Generation Sequencing (University of Rhode Island Genomics and Sequencing Center)
            type:  (MD_KeywordTypeCode) instrument
            thesaurusName:  (CI_Citation)
                title:  Originator Instrument Names
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/platform/53992 R/V Endeavor
            type:  (MD_KeywordTypeCode) platform
            thesaurusName:  (CI_Citation)
                title:  BCO-DMO Platform Names
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://gcmd.earthdata.nasa.gov/kms/concept/1bb21d0f-bf48-42b5-8e09-cc0d58407e4a Ships
            type:  (MD_KeywordTypeCode) platform
            thesaurusName:  (CI_Citation)
                title:  Global Change Master Directory (GCMD) Platform Keywords
                date:  (CI_Date)
                    date:  2024
                    dateType:  (CI_DateTypeCode) revision
                edition:  19
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA)
                    contactInfo:  (CI_Contact)
                        address:  (CI_Address)
                            city:  Greenbelt
                            administrativeArea:  MD
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://forum.earthdata.nasa.gov/app.php/tag/GCMD%2BKeywords
                            protocol:  HTTPS
                            name:  GCMD Keyword Forum Page
                            description:  Global Change Master Directory (GCMD). 2024. GCMD Keywords, Version 19. Greenbelt, MD: Earth Science Data and Information System, Earth Science Projects Division, Goddard Space Flight Center (GSFC), National Aeronautics and Space Administration (NASA). URL (GCMD Keyword Forum Page): https://forum.earthdata.nasa.gov/app.php/tag/GCMD+Keywords
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) custodian
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  https://vocab.ices.dk/services/pox/GetCodeDetail/SHIPC/32EV ENDEAVOR (call sign: WCE5063, ICES code: 32EV, 1976)
            type:  (MD_KeywordTypeCode) platform
            thesaurusName:  (CI_Citation)
                title:  ICES/SeaDataNet Ship Codes
                date: (inapplicable)
        descriptiveKeywords:  (MD_Keywords)
            keyword:
              Anchor:  http://lod.bco-dmo.org/id/deployment/848020 Narragansett Bay in Rhode Island, USA and offshore Atlantic Ocean transect across the Northeast U.S. Shelf (NES)
            type:  (MD_KeywordTypeCode) place
            thesaurusName:  (CI_Citation)
                title:  Provider Place Names
                date: (inapplicable)
        resourceConstraints:  (MD_Constraints)
            useLimitation:  accessLevel: Public
        resourceConstraints:  (MD_LegalConstraints)
            useConstraints:  (MD_RestrictionCode) otherRestrictions
            otherConstraints:  Cite as: Jenkins, Bethany D.; Bertin, Matthew (2023). Amplicon sequence variants (ASVs) recovered from samples and their related identification as Pseudo-nitzschia taxa and the methods used from 2016-09-26 to 2019-11-25 (NCEI Accession 0278248). [indicate subset used]. NOAA National Centers for Environmental Information. Dataset. https://www.ncei.noaa.gov/archive/accession/0278248. Accessed [date].
        resourceConstraints:  (MD_LegalConstraints)
            useLimitation:  Distribution liability: NOAA and NCEI make no warranty, expressed or implied, regarding these data, nor does the fact of distribution constitute such a warranty. NOAA and NCEI cannot assume liability for any damages caused by any errors or omissions in these data. If appropriate, NCEI can only certify that the data it distributes are an authentic copy of the records that were accepted for inclusion in the NCEI archives.
        resourceConstraints:  (MD_LegalConstraints)
            accessConstraints:  (MD_RestrictionCode) otherRestrictions
            otherConstraints:  Use liability: NOAA and NCEI cannot provide any warranty as to the accuracy, reliability, or completeness of furnished data. Users assume responsibility to determine the usability of these data. The user is responsible for the results of any application of this data for other than its intended purpose.
        resourceConstraints:  (MD_LegalConstraints)
            useConstraints:  (MD_RestrictionCode) license
            otherConstraints:
              Anchor:  CC-BY-4.0 This dataset is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) License.
            otherConstraints:
              Anchor:  CC-BY-4.0 SPDX License: Creative Commons Attribution 4.0 International (CC-BY-4.0)
        aggregationInfo:  (MD_AggregateInformation)
            aggregateDataSetName:  (CI_Citation)
                title:  Biological, chemical, physical, biogeochemical, ecological, environmental and other data collected from around the world during historical and contemporary periods of biological and chemical oceanographic exploration and research managed and submitted by the Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                date:  (CI_Date)
                    date:  2009-12-01
                    dateType:  (CI_DateTypeCode) publication
                identifier:  (MD_Identifier)
                    authority:  (CI_Citation)
                        title:  NOAA National Centers for Environmental Information
                        date: (inapplicable)
                    code:  gov.noaa.nodc:BCO-DMO
                citedResponsibleParty:  (CI_ResponsibleParty)
                    positionName: (unknown)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://www.ncei.noaa.gov/archive/accession/BCO-DMO
                            protocol:  HTTPS
                            name:  NCEI Collection
                            description:  Navigate directly to the URL for data access and direct download.
                            function:  (CI_OnLineFunctionCode) information
                    role: (unknown)
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:  NOAA National Centers for Environmental Information
                    role:  (CI_RoleCode) publisher
            associationType:  (DS_AssociationTypeCode) largerWorkCitation
            initiativeType:  (DS_InitiativeTypeCode) collection
        aggregationInfo:  (MD_AggregateInformation)
            aggregateDataSetName:  (CI_Citation)
                title:  Jenkins, B. D., Bertin, M. (2021) Amplicon sequence variants (ASVs) recovered from samples and their related identification as Pseudo-nitzschia taxa and the methods used. Biological and Chemical Oceanography Data Management Office (BCO-DMO). (Version 1) Version Date 2021-04-05. https://doi.org/10.26008/1912/bco-dmo.847469.1
                date:  (CI_Date)
                    date:  2021-04-05
                    dateType:  (CI_DateTypeCode) publication
                identifier:  (MD_Identifier)
                    authority:  (CI_Citation)
                        title:  International DOI Foundation (IDF)
                        date: (inapplicable)
                    code: https://doi.org/10.26008/1912/bco-dmo.847469.1
                citedResponsibleParty:  (CI_ResponsibleParty)
                    positionName: (unknown)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: https://doi.org/10.26008/1912/bco-dmo.847469.1
                            protocol:  HTTPS
                            name: https://doi.org/10.26008/1912/bco-dmo.847469.1
                            description:  originator dataset
                            function:  (CI_OnLineFunctionCode) download
                    role: (unknown)
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:
                      Anchor:  http://lod.bco-dmo.org/id/person/558172 Bethany D. Jenkins
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island (URI)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/558172
                            protocol:  HTTP
                            name:  University of Rhode Island website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:
                      Anchor:  http://lod.bco-dmo.org/id/person/839239 Matthew Bertin
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 The University of Rhode Island (URI)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/839239
                            protocol:  HTTP
                            name:  University of Rhode Island website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) principalInvestigator
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:
                      Anchor:  http://lod.bco-dmo.org/id/affiliation/191 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/affiliation/191
                            protocol:  HTTP
                            name:  website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) pointOfContact
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:
                      Anchor:  http://lod.bco-dmo.org/id/person/558172 Jenkins, Bethany D.
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 University of Rhode Island
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/558172
                            protocol:  HTTP
                            name:  University of Rhode Island website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    individualName:
                      Anchor:  http://lod.bco-dmo.org/id/person/839239 Bertin, Matthew
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1580 University of Rhode Island
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://lod.bco-dmo.org/id/person/839239
                            protocol:  HTTP
                            name:  University of Rhode Island website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) author
                citedResponsibleParty:  (CI_ResponsibleParty)
                    organisationName:
                      Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1416 Biological and Chemical Oceanography Data Management Office (BCO-DMO)
                    contactInfo:  (CI_Contact)
                        onlineResource:  (CI_OnlineResource)
                            linkage: http://bcodmo.org
                            protocol:  HTTP
                            name:  Biological and Chemical Oceanography Data Management Office website
                            description:  Institution web page
                            function:  (CI_OnLineFunctionCode) information
                    role:  (CI_RoleCode) publisher
                presentationForm:  (CI_PresentationFormCode) tableDigital
            associationType:  (DS_AssociationTypeCode) crossReference
            initiativeType:  (DS_InitiativeTypeCode) collection
        language:
          LanguageCode:  eng; USA
        characterSet:  (MD_CharacterSetCode) utf8
        topicCategory:  (MD_TopicCategoryCode) environment
        topicCategory:  (MD_TopicCategoryCode) oceans
        topicCategory:  (MD_TopicCategoryCode) biota
        extent:  (EX_Extent)
            geographicElement:  (EX_GeographicBoundingBox)
                westBoundLongitude:  -71.42
                eastBoundLongitude:  -70.8626
                southBoundLatitude:  40.206
                northBoundLatitude:  41.6716
            temporalElement:  (EX_TemporalExtent)
                extent:
                  TimePeriod:
                    beginPosition:  2016-09-26
                    endPosition:  2019-11-25
        supplementalInformation: (missing)
return to top
    distributionInfo:  (MD_Distribution)
        distributor:  (MD_Distributor)
            distributorContact:  (CI_ResponsibleParty)
                organisationName:
                  Anchor:  https://www.ncei.noaa.gov/archive/archive-management-system/OAS/bin/prd/jquery/institution/details/1730 NOAA National Centers for Environmental Information
                contactInfo:  (CI_Contact)
                    phone:  (CI_Telephone)
                        voice:  +1-301-713-3277
                    address:  (CI_Address)
                        electronicMailAddress:  NCEI.Info@noaa.gov
                role:  (CI_RoleCode) pointOfContact
            distributionOrderProcess:  (MD_StandardOrderProcess)
                fees:  In most cases, electronic downloads of the data are free. However, fees may apply for custom orders, data certifications, copies of analog materials, and data distribution on physical media.
                orderingInstructions:  Contact NCEI for other distribution options and instructions.
            distributorFormat:  (MD_Format)
                name:  TSV
                version: (unknown)
            distributorTransferOptions:  (MD_DigitalTransferOptions)
                transferSize:
                  Real:  0.248
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/0278248
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  NCEI Dataset Landing Page
                    description:  Navigate directly to the URL for a descriptive web page with download links.
                    function:  (CI_OnLineFunctionCode) information
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/oas/278248
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  Descriptive Information
                    description:  Navigate directly to the URL for a descriptive web page with download links.
                    function:  (CI_OnLineFunctionCode) information
                onLine:  (CI_OnlineResource)
                    linkage: https://www.ncei.noaa.gov/archive/accession/download/278248
                    protocol:  HTTPS
                    applicationProfile:  Web browser
                    name:  HTTPS
                    description:  Navigate directly to the URL for data access and direct download.
                    function:  (CI_OnLineFunctionCode) download
                onLine:  (CI_OnlineResource)
                    linkage: ftp://ftp-oceans.ncei.noaa.gov/nodc/archive/arc0212/0278248/
                    protocol:  FTP
                    applicationProfile:  Any FTP client
                    name:  FTP
                    description:  These data are available through the File Transfer Protocol (FTP). FTP is no longer supported by most internet browsers. You may copy and paste the FTP link to the data into an FTP client (e.g., FileZilla or WinSCP).
                    function:  (CI_OnLineFunctionCode) download
return to top
    dataQualityInfo:  (DQ_DataQuality)
        scope:  (DQ_Scope)
            level:  (MD_ScopeCode) dataset
        lineage:  (LI_Lineage)
            processStep:  (LE_ProcessStep)
                description:  NCEI Accession 0278248 v1.1 was published.
                dateTime:
                  DateTime:  2023-05-15T04:35:31Z
                output:  (LE_Source)
                    sourceCitation:  (CI_Citation)
                        title:  NCEI Accession 0278248 v1.1
                        date:  (CI_Date)
                            date: (inapplicable)
                            dateType:  (CI_DateTypeCode) publication
                        citedResponsibleParty:  (CI_ResponsibleParty)
                            individualName: (inapplicable)
                            contactInfo:  (CI_Contact)
                                onlineResource:  (CI_OnlineResource)
                                    linkage: https://www.ncei.noaa.gov/archive/accession/0278248/1.1
                                    protocol:  HTTPS
                                    name:  NCEI Accession 0278248 v1.1
                                    description:  published 2023-05-15T04:35:31Z
                                    function:  (CI_OnLineFunctionCode) download
                            role: (inapplicable)
return to top
    metadataMaintenance:  (MD_MaintenanceInformation)
        maintenanceAndUpdateFrequency:  (MD_MaintenanceFrequencyCode) asNeeded
        maintenanceNote:  Metadata are developed, maintained and distributed by NCEI. Updates are performed as needed to maintain currentness.
        contact:  (CI_ResponsibleParty)
            organisationName:  NOAA National Centers for Environmental Information
            role:  (CI_RoleCode) custodian
return to top
    acquisitionInformation:  (MI_AcquisitionInformation)
        platform:  (MI_Platform)
            identifier:  (MD_Identifier)
                code:  ENDEAVOR
            description:  UNIV. RHODE ISLAND RESEARCH VESSEL
            instrument: (missing)